ZFIN is now on Bluesky!
February 3, 2025 at 11:00 PM
ZFIN is now on Bluesky!
If you've benefited from ZebrafishRock and its community, you can thank ZFIN. i.e. ZebrafishRock is actually Kevin searching ZFIN
Want an easy way to support your model organism databases? Cite them!
Depending on the #zebrafish data you retrieve from ZFIN, you can show your support by using one of the formats below 🙏 🧪 #ZebrafishFunFacts
Depending on the #zebrafish data you retrieve from ZFIN, you can show your support by using one of the formats below 🙏 🧪 #ZebrafishFunFacts
![Citing ZFIN. We recommend the following formats for citing ZFIN in publications. For a general reference to the database, cite Bradford et al. 2022. For citing a specific entry in ZFIN: [Type of] data for this paper were retrieved from ZFIN, University of Oregon, Eugene, OR 97404-5274; URL: http://zfin.org/; [the date you retrieved the data cited].](https://cdn.bsky.app/img/feed_thumbnail/plain/did:plc:lmndrquzjoynsxgz7rcn5unj/bafkreicstoaakfnbcpp5pgpqjpzwdcaclgr6diy7clnhmmsw32v4mnrare)
October 22, 2025 at 5:12 PM
If you've benefited from ZebrafishRock and its community, you can thank ZFIN. i.e. ZebrafishRock is actually Kevin searching ZFIN
Want an easy way to support your model organism databases? Cite them!
Depending on the #zebrafish data you retrieve from ZFIN, you can show your support by using one of the formats below 🙏 🧪 #ZebrafishFunFacts
Depending on the #zebrafish data you retrieve from ZFIN, you can show your support by using one of the formats below 🙏 🧪 #ZebrafishFunFacts
October 22, 2025 at 4:32 PM
Want an easy way to support your model organism databases? Cite them!
Depending on the #zebrafish data you retrieve from ZFIN, you can show your support by using one of the formats below 🙏 🧪 #ZebrafishFunFacts
Depending on the #zebrafish data you retrieve from ZFIN, you can show your support by using one of the formats below 🙏 🧪 #ZebrafishFunFacts
We need to get ZFIN on here!
@zebrafishrock.bsky.social #zebrafish #SupportYourModelOrganismDataBases
@zebrafishrock.bsky.social #zebrafish #SupportYourModelOrganismDataBases
A lot of new people have followed us over the last few days.
Welcome!
If you check out the @flybase.bsky.social profile, you can see some useful/interesting FlyBase posts.
Welcome!
If you check out the @flybase.bsky.social profile, you can see some useful/interesting FlyBase posts.
November 12, 2024 at 1:42 AM
We need to get ZFIN on here!
@zebrafishrock.bsky.social #zebrafish #SupportYourModelOrganismDataBases
@zebrafishrock.bsky.social #zebrafish #SupportYourModelOrganismDataBases
ERRRRRRRYBODY follow ZFIN now stat
ZFIN is now on Bluesky!
February 4, 2025 at 7:58 AM
ERRRRRRRYBODY follow ZFIN now stat
ZFIN is here! *throws confetti* Welcome to Bluesky @zfinmod.bsky.social !
Of course you're in the starter pack!
go.bsky.app/Npxsd7h
Of course you're in the starter pack!
go.bsky.app/Npxsd7h
February 4, 2025 at 4:27 AM
ZFIN is here! *throws confetti* Welcome to Bluesky @zfinmod.bsky.social !
Of course you're in the starter pack!
go.bsky.app/Npxsd7h
Of course you're in the starter pack!
go.bsky.app/Npxsd7h
I am very serious about citing resources (ZFIN, Flybase, Wormbase, yeast, mouse, rat, human, etc) and asking authors to cite them precisely for this reason: the more we talk about them and cite them in our papers, the better chance we have at justifying why we should increase the budget 🧪
Treat biological databases as infrastructure, not projects www.nature.com/articles/d41...
Treat biological databases as infrastructure, not projects
Letter to the Editor
www.nature.com
August 20, 2026 at 1:10 PM
I am very serious about citing resources (ZFIN, Flybase, Wormbase, yeast, mouse, rat, human, etc) and asking authors to cite them precisely for this reason: the more we talk about them and cite them in our papers, the better chance we have at justifying why we should increase the budget 🧪
Help support ZFIN and other MODs by signing this open letter 🙏 🧪
The Global Biodata Coalition has an open letter campaign to show support for sustainable funding for biodata resources. Please take a minute to read and decide if you want to sign globalbiodata.org/open-letter-...
#biocuration #bioinformatics
#biocuration #bioinformatics
OPEN LETTER CAMPAIGN - Global Biodata Coalition
Careers at the Global Biodata Coalition.
globalbiodata.org
December 2, 2024 at 9:28 PM
Help support ZFIN and other MODs by signing this open letter 🙏 🧪
[Announcement]
Make your new lines findable in ZFIN and save time during publication revisions by registering new mutant/transgenic lines prior to publication. Submit new mutant/transgenic lines using this form: zfin.org/action/nomen...
#zebrafish
Make your new lines findable in ZFIN and save time during publication revisions by registering new mutant/transgenic lines prior to publication. Submit new mutant/transgenic lines using this form: zfin.org/action/nomen...
#zebrafish
ZFIN Submit a Proposed Mutant/Transgenic Line Name
zfin.org
April 10, 2025 at 7:27 PM
[Announcement]
Make your new lines findable in ZFIN and save time during publication revisions by registering new mutant/transgenic lines prior to publication. Submit new mutant/transgenic lines using this form: zfin.org/action/nomen...
#zebrafish
Make your new lines findable in ZFIN and save time during publication revisions by registering new mutant/transgenic lines prior to publication. Submit new mutant/transgenic lines using this form: zfin.org/action/nomen...
#zebrafish
#zebrafish New runx1-2A-creERT2 KI line now posted on zebrafishccr.org/runx1-2a-cre...
Beautiful work by genetics PhD student James Preston from the McGrail lab - check it out!
Beautiful work by genetics PhD student James Preston from the McGrail lab - check it out!
runx1-2A-creERT2 - Zebrafish Community Cre/lox Resource
KI Name runx1-2A-creERT2 Gene runx1 (ZFIN) ZFIN Gene Page runx1 family transcription factor 1 Lineage blood; HSCs Target Location exon 7 gRNA PAM GACGGCCTCTACAGACATGCTGG Genotype Tg(runx1-2A-creERT2; ...
zebrafishccr.org
April 9, 2025 at 8:45 PM
#zebrafish New runx1-2A-creERT2 KI line now posted on zebrafishccr.org/runx1-2a-cre...
Beautiful work by genetics PhD student James Preston from the McGrail lab - check it out!
Beautiful work by genetics PhD student James Preston from the McGrail lab - check it out!
Want an easy way to support your model organism databases? Cite them!
Depending on the #zebrafish data you retrieve from ZFIN, you can show your support by using one of the formats below 🙏 🧪
Depending on the #zebrafish data you retrieve from ZFIN, you can show your support by using one of the formats below 🙏 🧪
![Citing ZFIN. We recommend the following formats for citing ZFIN in publications. For a general reference to the database, cite Bradford et al. 2022. For citing a specific entry in ZFIN: [Type of] data for this paper were retrieved from ZFIN, University of Oregon, Eugene, OR 97404-5274; URL: http://zfin.org/; [the date you retrieved the data cited].](https://cdn.bsky.app/img/feed_thumbnail/plain/did:plc:lmndrquzjoynsxgz7rcn5unj/bafkreiccajk7q5k5sbpgxc7n6kfmyqe43q32t3ahcsrruiwdu7udqkbkhq)
May 27, 2024 at 2:50 PM
Want an easy way to support your model organism databases? Cite them!
Depending on the #zebrafish data you retrieve from ZFIN, you can show your support by using one of the formats below 🙏 🧪
Depending on the #zebrafish data you retrieve from ZFIN, you can show your support by using one of the formats below 🙏 🧪
this 100% sucks I can't get on like ZFIN even half the time
August 5, 2026 at 8:55 PM
this 100% sucks I can't get on like ZFIN even half the time
Same for ZFIN! @zfinmod.bsky.social put them in your papers' acknowledgements and cite them (Bradford et al. 2022 academic.oup.com/genetics/art...)
April 10, 2025 at 6:24 AM
Same for ZFIN! @zfinmod.bsky.social put them in your papers' acknowledgements and cite them (Bradford et al. 2022 academic.oup.com/genetics/art...)
March 26, 2025 at 1:34 PM
For the zebrafish folks, in case you don't know: if you use it -which you do-, you can cite ZFIN as Bradford et al 2022 academic.oup.com/genetics/art... 🧪🐟
August 21, 2026 at 4:41 AM
For the zebrafish folks, in case you don't know: if you use it -which you do-, you can cite ZFIN as Bradford et al 2022 academic.oup.com/genetics/art... 🧪🐟
New ZFIN paper:
ZFIN Updates to Support Zebrafish Environmental Exposure Data academic.oup.com/genetics/art...
@zfinmod.bsky.social @genetics-gsa.bsky.social
ZFIN Updates to Support Zebrafish Environmental Exposure Data academic.oup.com/genetics/art...
@zfinmod.bsky.social @genetics-gsa.bsky.social
ZFIN Updates to Support Zebrafish Environmental Exposure Data
Abstract. The Zebrafish Information Network (ZFIN, zfin.org) is the database resource for genetic, genomic, and phenotypic data from research using zebrafi
academic.oup.com
February 13, 2025 at 8:53 PM
New ZFIN paper:
ZFIN Updates to Support Zebrafish Environmental Exposure Data academic.oup.com/genetics/art...
@zfinmod.bsky.social @genetics-gsa.bsky.social
ZFIN Updates to Support Zebrafish Environmental Exposure Data academic.oup.com/genetics/art...
@zfinmod.bsky.social @genetics-gsa.bsky.social
Did you know you can search by phenotypes on ZFIN (zfin.org)? From the dropdown, select 'Phenotype' and try inputting any structure or behavior into the search bar. We'll give an example in this thread. And stay tuned for more tips and tricks under the hashtag: #ZFINtips! @zfinmod.bsky.social 🧪 1/n
March 7, 2026 at 12:27 PM
Did you know you can search by phenotypes on ZFIN (zfin.org)? From the dropdown, select 'Phenotype' and try inputting any structure or behavior into the search bar. We'll give an example in this thread. And stay tuned for more tips and tricks under the hashtag: #ZFINtips! @zfinmod.bsky.social 🧪 1/n
[Announcement]
ZFIN Updates Data to GRCz12tu Reference Genome
ZFIN is excited to announce that we have updated our site to use NCBI annotation data for the GRCz12tu reference genome. Please see our announcement here:
ZFIN Updates Data to GRCz12tu Reference Genome
ZFIN is excited to announce that we have updated our site to use NCBI annotation data for the GRCz12tu reference genome. Please see our announcement here:
ZFIN Updates Data to GRCz12tu Reference Genome - News - Confluence
zfin.atlassian.net
August 26, 2025 at 8:15 PM
[Announcement]
ZFIN Updates Data to GRCz12tu Reference Genome
ZFIN is excited to announce that we have updated our site to use NCBI annotation data for the GRCz12tu reference genome. Please see our announcement here:
ZFIN Updates Data to GRCz12tu Reference Genome
ZFIN is excited to announce that we have updated our site to use NCBI annotation data for the GRCz12tu reference genome. Please see our announcement here:
[Announcement]
ZFIN has been experiencing recent site outages. We apologize for the inconvenience. We are actively working on finding solutions to deal with these issues which seem to stem from a large increase in ‘bot’ traffic. Thank you for your patience and continued support of ZFIN!
ZFIN has been experiencing recent site outages. We apologize for the inconvenience. We are actively working on finding solutions to deal with these issues which seem to stem from a large increase in ‘bot’ traffic. Thank you for your patience and continued support of ZFIN!
March 31, 2025 at 8:48 PM
[Announcement]
ZFIN has been experiencing recent site outages. We apologize for the inconvenience. We are actively working on finding solutions to deal with these issues which seem to stem from a large increase in ‘bot’ traffic. Thank you for your patience and continued support of ZFIN!
ZFIN has been experiencing recent site outages. We apologize for the inconvenience. We are actively working on finding solutions to deal with these issues which seem to stem from a large increase in ‘bot’ traffic. Thank you for your patience and continued support of ZFIN!
With more than 750 sign-ups (including 250+ PIs), the ZR! Slack Group has turned into the primary source for questions and queries for the #zebrafish community! This resource gives in-depth discussions with the benefits of Slack Pro (courtesy of ZFIN). To sign-up, visit: forms.gle/AoW6Zbgb4qgt...
January 22, 2024 at 7:32 PM
With more than 750 sign-ups (including 250+ PIs), the ZR! Slack Group has turned into the primary source for questions and queries for the #zebrafish community! This resource gives in-depth discussions with the benefits of Slack Pro (courtesy of ZFIN). To sign-up, visit: forms.gle/AoW6Zbgb4qgt...
Are you really a #zebrafish lab if you aren't on ZFIN? 1772 so far! (on the lower end)
May 9, 2025 at 2:59 PM
Are you really a #zebrafish lab if you aren't on ZFIN? 1772 so far! (on the lower end)
I have to be better about doing this moving forward as I am regularly using ZFIN to find reagents.
For the zebrafish folks, in case you don't know: if you use it -which you do-, you can cite ZFIN as Bradford et al 2022 academic.oup.com/genetics/art... 🧪🐟
August 21, 2026 at 2:24 PM
I have to be better about doing this moving forward as I am regularly using ZFIN to find reagents.